View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21156_high_9 (Length: 226)
Name: NF21156_high_9
Description: NF21156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21156_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 76 - 221
Target Start/End: Complemental strand, 38602751 - 38602606
Alignment:
| Q |
76 |
caggctctggctagttgtgtttgctttcagagttttcttgatgacgttattgctgaatatgggactgatgaaaaacttgttgaaaacatgcctcttgttt |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38602751 |
caggctctggctagttgtgtttgctttcagagttttcttgatgacgttattgctgaatatgggactgatgaacaacttgttgaaaacatgcctcttgttt |
38602652 |
T |
 |
| Q |
176 |
tttctttggcttctttattacaaggtactgccacattgtttctgtg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38602651 |
tttctttggcttctttattacaaggtactgccacattgtttctgtg |
38602606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University