View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21156_low_10 (Length: 238)
Name: NF21156_low_10
Description: NF21156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21156_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 17 - 225
Target Start/End: Complemental strand, 21254482 - 21254274
Alignment:
| Q |
17 |
acctcaatcattcaaatgttttttgggtctataaatgctttatgagggaaaaaaggagattaaaaatgttttaattaagaaaaatgtcattaatataatg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
21254482 |
acctcaatcattcaaatgttttttgggtctataaatgctttatgaggggaaaaaggagattaaaaatgttttaattaagaaaaatgtcattaatgtaatg |
21254383 |
T |
 |
| Q |
117 |
taataggagaatgctaaaagtatcgaatgcggaaactcaccattgtttcatctgttcctttctttttacatactcatcagcaacctgacaaataaaacaa |
216 |
Q |
| |
|
| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
21254382 |
tgataggagaatgctaaaagtatcgaatgcagaaactcaccattgtttcatctgttcctttcttttgacatactcatcagcaacctgacaaataaaacag |
21254283 |
T |
 |
| Q |
217 |
agaataatc |
225 |
Q |
| |
|
||||||||| |
|
|
| T |
21254282 |
agaataatc |
21254274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University