View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21156_low_12 (Length: 220)
Name: NF21156_low_12
Description: NF21156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21156_low_12 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 164 - 220
Target Start/End: Complemental strand, 7560069 - 7560013
Alignment:
| Q |
164 |
aaatcaaatgaatcacaagacctctacgaaaaacataacaacgatgttaatttcact |
220 |
Q |
| |
|
|||||||||||||||||| || |||| ||||||||||||| |||||||||||||||| |
|
|
| T |
7560069 |
aaatcaaatgaatcacaatacttctatgaaaaacataacatcgatgttaatttcact |
7560013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 12 - 41
Target Start/End: Original strand, 27097800 - 27097829
Alignment:
| Q |
12 |
atgaaaaatgattcagatgagtgattctat |
41 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
27097800 |
atgaaaaatgattcagatgagtgattctat |
27097829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University