View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21156_low_7 (Length: 256)
Name: NF21156_low_7
Description: NF21156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21156_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 20 - 178
Target Start/End: Original strand, 36356571 - 36356730
Alignment:
| Q |
20 |
gatcatataatcctcataatatgaattagatgcggagggtggaaaaagaaattgtctaaa-ttaccgcaacgctccactaattgggctctagagtaaaag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36356571 |
gatcatataatcctcataatatgaattagatgtggagggtggaaaaagaaattgtctaaagttaccgcaacgctcaactaattgggctctagagtaaaag |
36356670 |
T |
|
| Q |
119 |
tccaacatgatattagagccggatatgactcccaaaaagaaaacaaagtaagggagcttc |
178 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36356671 |
tccaacatgatattagagcccgatatgactcccaaaaagaaaacaaagtaagggagcttc |
36356730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University