View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21157_high_15 (Length: 242)
Name: NF21157_high_15
Description: NF21157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21157_high_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 70 - 223
Target Start/End: Complemental strand, 46032566 - 46032413
Alignment:
| Q |
70 |
attaattatattcatacttgtttttgtttggaatttagttgtggattgacgcttatgtccaacacatttggaaggagacgtttgcaattctgtttcatga |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46032566 |
attaattatattcatacttgtttttgtttggaatttagttgtggattgacgcttatgtccaacacatttggaaggagacgtttgcaattctgtttcatga |
46032467 |
T |
 |
| Q |
170 |
acaaattgccaaacagaattttcaccaagtccaccatcaaagctgagggagatg |
223 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
46032466 |
acaaattgccaaacagaattttcactaagtccaccatcaaagctgagggagatg |
46032413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 63 - 223
Target Start/End: Complemental strand, 46019910 - 46019741
Alignment:
| Q |
63 |
aagcaaaattaattatattcatacttgtttttgtttggaatttagttgtggattgacgctta------tgtccaacacatttg---gaaggagacgtttg |
153 |
Q |
| |
|
||||||||| |||| |||| ||| |||||| ||||| ||||||| ||||||||||| |||| || ||||||||| || | |||||||||||| |
|
|
| T |
46019910 |
aagcaaaatcaattgtattgatagttgtttgtgtttctaatttagctgtggattgacccttaacgagttggccaacacatatgagaggaggagacgtttg |
46019811 |
T |
 |
| Q |
154 |
caattctgtttcatgaacaaattgccaaacagaattttcaccaagtccaccatcaaagctgagggagatg |
223 |
Q |
| |
|
||||| ||||||||||||||| |||| | | ||||||||| | |||| ||||||||||||||||||| |
|
|
| T |
46019810 |
caattgtgtttcatgaacaaaatgcctgaaacaattttcacaatgtccgaaatcaaagctgagggagatg |
46019741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University