View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21157_high_18 (Length: 237)
Name: NF21157_high_18
Description: NF21157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21157_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 52040148 - 52039931
Alignment:
| Q |
1 |
tattgtggtaattcttcttccacattggtgtatcttatgcggcnnnnnnngctctacagcagacattgtttggcttgtaaacaatatggttaggaaaata |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| |||||||| |||||||||||||||| ||||||||| | ||||||||||| |
|
|
| T |
52040148 |
tattgtggtaattcttcttccccattggtgtatcttctgcggcaaaaaaagctctacaatagacattgtttggcttctaaacaatacgattaggaaaata |
52040049 |
T |
 |
| Q |
101 |
cgtttcactttcaaactataaagtttatttccaaagtttattcttccaaacttatcatgttgttggctattaatgtttgcaagatagttttgatattcat |
200 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52040048 |
cgtttcaccttcaaactataaagttgatttccaaagtttattcttccaaacttatcat---gttggctattaatgtttgcaagatagttttgatattcat |
52039952 |
T |
 |
| Q |
201 |
tatttgatgattgttattttg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
52039951 |
tatttgatgattgttattttg |
52039931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 127 - 216
Target Start/End: Original strand, 13928349 - 13928435
Alignment:
| Q |
127 |
atttccaaagtttattcttccaaac-ttatcatgttgttggctattaatgtttgcaagatagttttgatattcattatttgatgattgtta |
216 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||| | |||||| ||||||||||||||| || | |||||| ||||||||| |
|
|
| T |
13928349 |
atttccaaagttta--cttccaaaaattatcatgttgttggctct--atgtttccaagatagttttgatttttactatttgttgattgtta |
13928435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University