View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21157_high_21 (Length: 216)
Name: NF21157_high_21
Description: NF21157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21157_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 46 - 204
Target Start/End: Original strand, 6887569 - 6887727
Alignment:
| Q |
46 |
tttgcgtaatcagcgcctgtgagtctttgttggaataattcatattctctaattgattattaaattgcaaaaagcatattatctttaccaatttttaaaa |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6887569 |
tttgcgtaatcagcgcctgtgagtctttgttggaataattcatattctctaattgattattaaattgcaaaaagcatattatctttaccaatttttaaaa |
6887668 |
T |
 |
| Q |
146 |
gggttttgattccatagtaggtggcaagttttggaatgatatagaagaaaaggtagcgg |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6887669 |
gggttttgattccatagtaggtggcaagttttggaatgatatagaagaaaaggtagcgg |
6887727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University