View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21157_high_23 (Length: 209)
Name: NF21157_high_23
Description: NF21157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21157_high_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 6e-70; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 19 - 192
Target Start/End: Original strand, 4817758 - 4817931
Alignment:
| Q |
19 |
atcaccagattgaccgagttcattgaaggtacgcgcatattttttaacatgaatctatgaagcacatatacttattgaattatgtgtgttccggtatcaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
4817758 |
atcaccagattgaccgagttcattgaaggtacgtacatattttttaacatgaatctatgaagcacatatactcattgaattatgcgtgttccggtatcaa |
4817857 |
T |
 |
| Q |
119 |
atatatatagtgttcgataccaacacacaccgtcacatatatgtcattttcttaaattattatcgatgttcaca |
192 |
Q |
| |
|
|||| ||| ||||||| |||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4817858 |
atatgtatcatgttcgacaccaacacacactgtcacatatatgtcaatttcttaaattattatcgatgttcaca |
4817931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 187
Target Start/End: Complemental strand, 18622445 - 18622416
Alignment:
| Q |
158 |
tatgtcattttcttaaattattatcgatgt |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
18622445 |
tatgtcattttcttaaattattatcgatgt |
18622416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University