View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21157_low_21 (Length: 236)
Name: NF21157_low_21
Description: NF21157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21157_low_21 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 14 - 236
Target Start/End: Original strand, 2140037 - 2140259
Alignment:
| Q |
14 |
caaaaattatacttaaattttaacaaaattactaaatgacaatgattttgctaaagtcattatcaatttaagcattaacataatgttagatggtagcata |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2140037 |
caaaaattatacttaaattttaacaaaattactaaatgacaatgattttgctaaagtcattatcaatttaagcattaacataatgttagatggtagcata |
2140136 |
T |
|
| Q |
114 |
nnnnnnngttaaaaagaagtttgaaaaattaaaatatttggtgcaggtgaactatgtaaaaccttcagctcctactgttgcaattccaataataaccgtt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2140137 |
ttattttgttaaaaagaagtttgaaaaattaaaatatttggtgcaggtgaactatgtaaaaccttcagctcctactgttgtaattccaataataaccgtt |
2140236 |
T |
|
| Q |
214 |
ccaccttctcaaccagccaaaac |
236 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
2140237 |
ccaccttctcaaccagccaaaac |
2140259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 147 - 185
Target Start/End: Original strand, 2124784 - 2124822
Alignment:
| Q |
147 |
atatttggtgcaggtgaactatgtaaaaccttcagctcc |
185 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
2124784 |
atatttggtgcaggtgaactatgtaaatcctacagctcc |
2124822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University