View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21159_high_9 (Length: 248)
Name: NF21159_high_9
Description: NF21159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21159_high_9 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 5 - 248
Target Start/End: Complemental strand, 28600610 - 28600369
Alignment:
| Q |
5 |
tccaagaatatagctttatgcgacaaagtgtggaaattttatattttttcaaatgaaaataacttggcttaaatgatttccttaaattaatgtatttaat |
104 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
28600610 |
tccaagtatatagctttatgtgacaaagtgtggaaattttatatttt--caaatgaaaataacttggcttaaatgatttcctcaaattaatgtatttaat |
28600513 |
T |
|
| Q |
105 |
tttatctcttcctacatattgcagattccagctgaaacatttgaggttgagaaatttgatgaaccaatgcagaatatcactatagacttgatctttggtc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28600512 |
tttatctcttcctacatattgcagattccagctgaaacatttgaggttgagaaatttgatgaaccaatgcagaatatcactatagacttgatctttggtc |
28600413 |
T |
|
| Q |
205 |
tcggaataacgaaattggtcatcggattttcattcatgagacat |
248 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28600412 |
ttggaataacgaaattggtcatcggattttcattcatgagacat |
28600369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University