View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21159_low_14 (Length: 226)
Name: NF21159_low_14
Description: NF21159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21159_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 29 - 207
Target Start/End: Complemental strand, 30923343 - 30923164
Alignment:
| Q |
29 |
gctgacatgtgtcggacatcaaacacaccttcgatcagaggtgtcgt-gcttcagagctttgtagctcaaaatcaaaatgatcttcaagtaatagttcaa |
127 |
Q |
| |
|
|||||||| ||||||||| | ||||||||||||||| | |||| || |||||| |||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
30923343 |
gctgacatatgtcggacacaagacacaccttcgatcaaaagtgttgttgcttcatagctttgtagctcaaaatcaaaataagcttcaagtaatagttcaa |
30923244 |
T |
 |
| Q |
128 |
tttttcaaagagaaaaataaacctgagggtcaagaactttatctacaatgcaaggggaagcgaggtggaaaactccatcg |
207 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30923243 |
tttttcaaagagaaaaacaaacctgagggtcaagaactttatctacaatgcaaggcgaagcgaggtggaaaactccatcg |
30923164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University