View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2115_high_4 (Length: 268)
Name: NF2115_high_4
Description: NF2115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2115_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 67; Significance: 8e-30; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 72 - 142
Target Start/End: Complemental strand, 36750044 - 36749974
Alignment:
| Q |
72 |
agtagtactatgactattcatagtgctgcgttgatttctcatttacttaagcggtcttaggattggttgaa |
142 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36750044 |
agtagtactatgactattcatagtgccgcgttgatttctcatttacttaagcggtcttaggattggttgaa |
36749974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 12 - 81
Target Start/End: Complemental strand, 36750554 - 36750486
Alignment:
| Q |
12 |
agagaagtattaaatcttaatttactaattatcacatgttgatatgggaatatgatcggtagtagtacta |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36750554 |
agagaagtattaaatcttaatttactaattatcacatgttgatatgggaata-gatcggtagtagtacta |
36750486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University