View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2115_low_10 (Length: 223)
Name: NF2115_low_10
Description: NF2115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2115_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 17 - 158
Target Start/End: Complemental strand, 33043151 - 33043010
Alignment:
| Q |
17 |
agttagagcttcatcactagcttatgtatggtgagctagctcgtttactttaaagttcatttgatcaataatgaaatgcatattgcaatcacagctagtt |
116 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33043151 |
agttagagcttcatcactagcttatggatggtgagctagctcgtttactttaaagttcatttgatcaataatgaaatgcatattgcaatcacaactagtt |
33043052 |
T |
|
| Q |
117 |
ttttctcttgagtgtcatgctctaatatggtattagaagata |
158 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
33043051 |
ttttctctcgagtgtcatgctctaatacggtattagaagata |
33043010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 67 - 133
Target Start/End: Complemental strand, 33041028 - 33040962
Alignment:
| Q |
67 |
taaagttcatttgatcaataatgaaatgcatattgcaatcacagctagttttttctcttgagtgtca |
133 |
Q |
| |
|
||||||||| ||||||||| |||||||||| ||||||||||| || |||| |||||||||||||| |
|
|
| T |
33041028 |
taaagttcagatgatcaatagtgaaatgcatcttgcaatcacaattaattttctctcttgagtgtca |
33040962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University