View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2115_low_5 (Length: 277)
Name: NF2115_low_5
Description: NF2115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2115_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 17 - 267
Target Start/End: Original strand, 42024681 - 42024933
Alignment:
| Q |
17 |
acattcttggcagctgcgctgaaggcttccctgtgggttatatcaggattgacagacttaatgcgttggatctcgtccctgcagatggaccgtatttaga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42024681 |
acattcttggcagctgcgctgaaggcttccctgtgggttatatcaggattgacagacttaatgcgttggatctcgtccctgcagatggaccgtatttaga |
42024780 |
T |
|
| Q |
117 |
tttacttcacacttttataacattaacaagaaaatttaatattatatatcagaaattgaatatgaagtt--nnnnnnngtacaatggttttaaatgacta |
214 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42024781 |
tttacttcacactttaataacattaacaagaaaatttaatattatatatcagaaattgaatatgaagttaaaaaaaaagtacaatggttttaaatgacta |
42024880 |
T |
|
| Q |
215 |
tactcacttgatgaatcggttgtatgctgagggaactctctgtcttttctctg |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42024881 |
tactcacttgatgaatcggttgtatgctgagggaactctctgtcttttctctg |
42024933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University