View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2115_low_8 (Length: 268)

Name: NF2115_low_8
Description: NF2115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2115_low_8
NF2115_low_8
[»] chr3 (2 HSPs)
chr3 (72-142)||(36749974-36750044)
chr3 (12-81)||(36750486-36750554)


Alignment Details
Target: chr3 (Bit Score: 67; Significance: 8e-30; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 72 - 142
Target Start/End: Complemental strand, 36750044 - 36749974
Alignment:
72 agtagtactatgactattcatagtgctgcgttgatttctcatttacttaagcggtcttaggattggttgaa 142  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
36750044 agtagtactatgactattcatagtgccgcgttgatttctcatttacttaagcggtcttaggattggttgaa 36749974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 12 - 81
Target Start/End: Complemental strand, 36750554 - 36750486
Alignment:
12 agagaagtattaaatcttaatttactaattatcacatgttgatatgggaatatgatcggtagtagtacta 81  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
36750554 agagaagtattaaatcttaatttactaattatcacatgttgatatgggaata-gatcggtagtagtacta 36750486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University