View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2115_low_9 (Length: 236)

Name: NF2115_low_9
Description: NF2115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2115_low_9
NF2115_low_9
[»] chr3 (1 HSPs)
chr3 (1-220)||(54277727-54277946)


Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 54277727 - 54277946
Alignment:
1 ttaatggaattgtatgaactgattatttaactaccatttgtagggtgtgtttgatggacattgtggaagtgagccagatcatggtgtgtcagccgttgga 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
54277727 ttaatggaattgtatgaactgattatttaactaccatttgtagggtgtgtttgatggacattgtggaagtgagctagatcatggtgtgtcagccgttgga 54277826  T
101 tatggtacatcaaagggtttggattacattatagtgaagaattcatggggagcaaagtggggtgagaaagggtttattaggatgaagagaaacattggaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54277827 tatggtacatcaaagggtttggattacattatagtgaagaattcatggggagcaaagtggggtgagaaagggtttattaggatgaagagaaacattggaa 54277926  T
201 agtctgaagggatttgtgga 220  Q
    ||||||||||||||||||||    
54277927 agtctgaagggatttgtgga 54277946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University