View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21161_high_10 (Length: 247)
Name: NF21161_high_10
Description: NF21161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21161_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 37647033 - 37647262
Alignment:
| Q |
1 |
cctccagcagggttggcagcggcaagaatggaagtacgagcattcagtgttgcttgtattcctgcttttgtgatactgatagtttgttgttccatagcct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37647033 |
cctccagcagggttggcagcggcaagaatggaagtacgagcattcagtgttgcttgtattcctgcttttgtgatactaatagtttgttgttccatagcct |
37647132 |
T |
 |
| Q |
101 |
catgaattgcaaccttcaatccaatcaaatatgagatactttccagtccatgaccctcaaatgccagtnnnnnnntacatgcctcttacctgatctctta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
37647133 |
catgaattgcaaccttcaatccaatcaaatatgagatactttccagtccatgaccctcaaatgccagtaaaaaaatgcatgcctcttacctgatctctta |
37647232 |
T |
 |
| Q |
201 |
tgtccatcttgtcaaattcatcgatgcagc |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37647233 |
tgtccatcttgtcaaattcatcgatgcagc |
37647262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 4 - 155
Target Start/End: Original strand, 14760173 - 14760324
Alignment:
| Q |
4 |
ccagcagggttggcagcggcaagaatggaagtacgagcattcagtgttgcttgtattcctgcttttgtgatactgatagtttgttgttccatagcctcat |
103 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| || || |||||||| |||| |
|
|
| T |
14760173 |
ccagaaggattggcagcggcaagaatggaagtacgggcattaagtgttgcttgtattcctgcttttgtgatactgatagtctgctgctccatagcttcat |
14760272 |
T |
 |
| Q |
104 |
gaattgcaaccttcaatccaatcaaatatgagatactttccagtccatgacc |
155 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||| | |||||||||| |
|
|
| T |
14760273 |
gaattgcaaccttcagtgcaatcaaatatgagatacttttcggtccatgacc |
14760324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 182 - 229
Target Start/End: Original strand, 14760352 - 14760399
Alignment:
| Q |
182 |
cctcttacctgatctcttatgtccatcttgtcaaattcatcgatgcag |
229 |
Q |
| |
|
||||||||||||||| | |||||||||| |||||||||||||||||| |
|
|
| T |
14760352 |
cctcttacctgatctttggtgtccatcttatcaaattcatcgatgcag |
14760399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University