View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21161_low_11 (Length: 240)
Name: NF21161_low_11
Description: NF21161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21161_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 14629153 - 14628945
Alignment:
| Q |
1 |
attattgaaattgaaaatggaacaagnnnnnnnnctttccagcaaatataaataaccacatttcttcaagtagaaagtaagttggtctcgtcttccctca |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14629153 |
attattgaaattgaaaatggaacaagtttttttt-tttccagcaaatataaataaccacatttcttcaagtagaaagtaagttggtctcgtcttccctca |
14629055 |
T |
|
| Q |
101 |
gaaaattcgtaataataaactatgcataacagtatgaaaagaaattcttgac--tgagataatcattaaatttcaaaagaatttttcactattctcaaac |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
14629054 |
gaaaattcgtaataataaactatgcataacagtatgaaaagaaattcttgactttgagataatcattaaatttcaaaagaatttttcacgattctcaaac |
14628955 |
T |
|
| Q |
199 |
attcatgcaa |
208 |
Q |
| |
|
|||||||||| |
|
|
| T |
14628954 |
attcatgcaa |
14628945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University