View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21162_high_20 (Length: 246)
Name: NF21162_high_20
Description: NF21162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21162_high_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 18090244 - 18090028
Alignment:
| Q |
1 |
tcgctctgctgccacttggagaccccacctaaagcccaaaacttcagcaactaccatatcagccaccagataagaattcttggacaccgcagccaccacc |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||||||||||| |
|
|
| T |
18090244 |
tcgctccgctgccacttggagaccccacctaaagcccaaaacttcagcaactaccagaacag------------aattcttggacaccgcagccaccac- |
18090158 |
T |
|
| Q |
101 |
acattagcattatgatctctaatcactaggccccaaaataccttaccgtcgtgaccgcaaccagcatcaatgttcacctctagataacctactggaggag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18090157 |
--attagcattatgatctctaatcactaggctccaaaataccttacggtcgtgaccgcaaccagcatcaatgttcacctctagataacctactggaggag |
18090060 |
T |
|
| Q |
201 |
cttcccaagagttcagacgcagccaccacatt |
232 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |
|
|
| T |
18090059 |
cttcccaagatttcagacgcagccaccacatt |
18090028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 52758025 - 52757809
Alignment:
| Q |
1 |
tcgctctgctgccacttggagaccccacctaaagcccaaaacttcagcaactaccatatcagccaccagataagaattcttggacaccgcagccaccacc |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||||||||||| |
|
|
| T |
52758025 |
tcgctccgctgccacttggagaccccacctaaagcccaaaacttcagcaactaccagaacag------------aattcttggacaccgcagccaccac- |
52757939 |
T |
|
| Q |
101 |
acattagcattatgatctctaatcactaggccccaaaataccttaccgtcgtgaccgcaaccagcatcaatgttcacctctagataacctactggaggag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52757938 |
--attagcattatgatctctaatcactaggctccaaaataccttacggtcgtgaccgcaaccagcatcaatgttcacctctagataacctactggaggag |
52757841 |
T |
|
| Q |
201 |
cttcccaagagttcagacgcagccaccacatt |
232 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |
|
|
| T |
52757840 |
cttcccaagatttcagacgcagccaccacatt |
52757809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 10 - 51
Target Start/End: Complemental strand, 23547907 - 23547866
Alignment:
| Q |
10 |
tgccacttggagaccccacctaaagcccaaaacttcagcaac |
51 |
Q |
| |
|
||||||||||||||||||||| || ||||| ||||||||||| |
|
|
| T |
23547907 |
tgccacttggagaccccacctgaaacccaagacttcagcaac |
23547866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University