View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21162_high_21 (Length: 245)
Name: NF21162_high_21
Description: NF21162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21162_high_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 35673579 - 35673808
Alignment:
| Q |
1 |
agaaactaggtttgaatattattgatgtgttgatgaatggtttgggggttgagaacccggttggtgatgactcgaaccggtttagttcgattatgtgggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35673579 |
agaaactaggtttgaatattattgatgtgttgatgaatggtttgggggttgagaacccggttggtgatgactcgaaccggtttagttcgattatgtgggt |
35673678 |
T |
|
| Q |
101 |
ttctgagtgtttgccaggaaataaacccggttcaatgggtgggttttacccgtttatagtgggattgcagtatcagataaggtgtcaaaaatattcgttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35673679 |
ttctgagtgtttgccaggaaataaacccggttcaatgggtgggttttacccgtttatagtgggattgcagtatcagataaggtgtcaaaaatattcgttg |
35673778 |
T |
|
| Q |
201 |
ttgtcggattcaggtggatgggtttctgtg |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
35673779 |
ttgtcggattcaggtggatgggtttctgtg |
35673808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University