View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21162_low_10 (Length: 295)
Name: NF21162_low_10
Description: NF21162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21162_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 15 - 285
Target Start/End: Complemental strand, 29143281 - 29143008
Alignment:
| Q |
15 |
agattcatcattgggaacaagatagtgaagattcaatggctat---caacgtatgcaattgtatcgttttccatgtttgtgtttgctaaactttttatac |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29143281 |
agattcatcattgggaacaagatagtgaagcttcaatggctattatcaacgtatgcaattgtatcgttttccatgtttgtgtttgctaaactttttatac |
29143182 |
T |
 |
| Q |
112 |
taggatttgattaaccctccttgattgtaatttaattctcatttgattatacaatagatgtttatttcgatttagctaattgtttatattctttatgctc |
211 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29143181 |
taggatttggttaaccctccttgattgtaatttaattctcatttgattatgcaatagatgtttatttcgatttagctaattgtttatattctttatgctc |
29143082 |
T |
 |
| Q |
212 |
tttgttaatttaatcgttatcgaattaataggtgaataatcatgaataacttttttatttagtttctccctttg |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29143081 |
tttgttaatttaatcgttatcgaattaataggtgaataatcatgaataacttttttatttagtttctcgctttg |
29143008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University