View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21162_low_14 (Length: 265)
Name: NF21162_low_14
Description: NF21162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21162_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 12 - 248
Target Start/End: Original strand, 4093244 - 4093480
Alignment:
| Q |
12 |
tcatcattgagttagttatgacatagaaggattggctttcatctaacaaggcttagtggaaatagttatacatttgtatcacatttgcaccccttttgca |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4093244 |
tcatcattgagttagttatgacatagaaggattggttttcatctaacaaggcttagtggaaatagttatacatttgtatcacatttgcaccccttttgca |
4093343 |
T |
 |
| Q |
112 |
ttttacaaatactattctgtttatgtcacattttttcttagatgaaatcagtttatcattcgcttctgctttgctttgtttctacaagttttcgtatcca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4093344 |
ttttacaaatactattctgtttatgtcatattttttcttagatgaaatcagtttatcattcgcttctgctttgctttgtttctacaagttttcgtatcca |
4093443 |
T |
 |
| Q |
212 |
ctataagtttgattgaggtttaagatggtgttgcagc |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4093444 |
ctataagtttgattgaggtttaagatggtgttgcagc |
4093480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University