View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21162_low_19 (Length: 249)
Name: NF21162_low_19
Description: NF21162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21162_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 33 - 192
Target Start/End: Original strand, 225425 - 225584
Alignment:
| Q |
33 |
aattgaattgaattttgtgatgtcggatcgtacgaaggtggtgattcggcacttgcctccaacaattacacaagactctcttttgcctttaatcgactct |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
225425 |
aattgaattgaattttgtgatgtcggatcgtacgaaggtggtgattcggcacttgcctccaacaattacacaagactctcttttgcctttaatcgactct |
225524 |
T |
|
| Q |
133 |
tcattcgctggtcgttacaattggttctcttttcatcctcctaaaatcacaaggtacgct |
192 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
225525 |
tccttcgctggtcgttacaattggttctcttttcatcctcctaaaatcacaaggtacgct |
225584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 49 - 190
Target Start/End: Complemental strand, 17864183 - 17864042
Alignment:
| Q |
49 |
gtgatgtcggatcgtacgaaggtggtgattcggcacttgcctccaacaattacacaagactctcttttgcctttaatcgactcttcattcgctggtcgtt |
148 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |||||||| |||||| |||||| |
|
|
| T |
17864183 |
gtgatgtcggatagtacgaaggtggtgattcggcacttgcctccaacaattacacaagactctcttatgcccttaattgactcttccttcgctagtcgtt |
17864084 |
T |
|
| Q |
149 |
acaattggttctcttttcatcctcctaaaatcacaaggtacg |
190 |
Q |
| |
|
|||||||| || |||| |||||||| |||||||| ||||||| |
|
|
| T |
17864083 |
acaattggctccctttccatcctcccaaaatcaccaggtacg |
17864042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 49 - 140
Target Start/End: Complemental strand, 52189838 - 52189747
Alignment:
| Q |
49 |
gtgatgtcggatcgtacgaaggtggtgattcggcacttgcctccaacaattacacaagactctcttttgcctttaatcgactcttcattcgc |
140 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |||||||| ||||| |
|
|
| T |
52189838 |
gtgatgtgggatagtacgaaggtggtgattcggcacttgcctccaacaattacacaagactctcttatgcccttaattgactcttccttcgc |
52189747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University