View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21162_low_19 (Length: 249)

Name: NF21162_low_19
Description: NF21162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21162_low_19
NF21162_low_19
[»] chr2 (1 HSPs)
chr2 (33-192)||(225425-225584)
[»] chr8 (1 HSPs)
chr8 (49-190)||(17864042-17864183)
[»] chr4 (1 HSPs)
chr4 (49-140)||(52189747-52189838)


Alignment Details
Target: chr2 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 33 - 192
Target Start/End: Original strand, 225425 - 225584
Alignment:
33 aattgaattgaattttgtgatgtcggatcgtacgaaggtggtgattcggcacttgcctccaacaattacacaagactctcttttgcctttaatcgactct 132  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
225425 aattgaattgaattttgtgatgtcggatcgtacgaaggtggtgattcggcacttgcctccaacaattacacaagactctcttttgcctttaatcgactct 225524  T
133 tcattcgctggtcgttacaattggttctcttttcatcctcctaaaatcacaaggtacgct 192  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
225525 tccttcgctggtcgttacaattggttctcttttcatcctcctaaaatcacaaggtacgct 225584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 49 - 190
Target Start/End: Complemental strand, 17864183 - 17864042
Alignment:
49 gtgatgtcggatcgtacgaaggtggtgattcggcacttgcctccaacaattacacaagactctcttttgcctttaatcgactcttcattcgctggtcgtt 148  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |||||||| |||||| ||||||    
17864183 gtgatgtcggatagtacgaaggtggtgattcggcacttgcctccaacaattacacaagactctcttatgcccttaattgactcttccttcgctagtcgtt 17864084  T
149 acaattggttctcttttcatcctcctaaaatcacaaggtacg 190  Q
    |||||||| || |||| |||||||| |||||||| |||||||    
17864083 acaattggctccctttccatcctcccaaaatcaccaggtacg 17864042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 49 - 140
Target Start/End: Complemental strand, 52189838 - 52189747
Alignment:
49 gtgatgtcggatcgtacgaaggtggtgattcggcacttgcctccaacaattacacaagactctcttttgcctttaatcgactcttcattcgc 140  Q
    ||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |||||||| |||||    
52189838 gtgatgtgggatagtacgaaggtggtgattcggcacttgcctccaacaattacacaagactctcttatgcccttaattgactcttccttcgc 52189747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University