View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21162_low_22 (Length: 237)
Name: NF21162_low_22
Description: NF21162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21162_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 225776 - 225988
Alignment:
| Q |
1 |
tgaatatgctccttcacagcgtgttccaaaccactcttcttctaagaagacagaagacgctcgtgatggtaccatatttaaagatcccgactatctccaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
225776 |
tgaatatgctccttcacagcgtgttccaaaccactctt---ctaagaagccagaagacgctcgcgatggtaccatatttaaagatcccgactatctccaa |
225872 |
T |
 |
| Q |
101 |
tttcttcaacaaattgcaaagcctgtcgagaatctccctagtgctgaaatacagttggacaaaagggaagccttacggaaagatattcctatagtcacac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
225873 |
tttcttcaacaaattgcaaagcctgtcgagaatctccctagtgctgaaatacagttggacaaaagggaagccgtacggaaagatattcctatagtcacac |
225972 |
T |
 |
| Q |
201 |
cacttatggactttgt |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
225973 |
cacttatggactttgt |
225988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University