View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21162_low_25 (Length: 203)
Name: NF21162_low_25
Description: NF21162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21162_low_25 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 19 - 187
Target Start/End: Complemental strand, 10615235 - 10615067
Alignment:
| Q |
19 |
tctattgcaagggcgggtcttcctttgacgaggtttaccctccgacattgtttcggccaccatagttatgctggaatctatggtttattatccaagtgtc |
118 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10615235 |
tctattgcaagggtgggtcttcctttgacgaggtttaccctccgacattgtttcggccaccatagttatgctggaatctattgtttattatccaagtgtc |
10615136 |
T |
|
| Q |
119 |
aaggcttccaacatttggatcttgaacttccgtttctgaatgatcaacatgttgtccaattgtcttcat |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10615135 |
aaggcttccaacatttggatcttgaacttccgtttctgaatgatcaacatgttgtccaattgtcttcat |
10615067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 111; Significance: 3e-56; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 21 - 183
Target Start/End: Complemental strand, 6416606 - 6416444
Alignment:
| Q |
21 |
tattgcaagggcgggtcttcctttgacgaggtttaccctccgacattgtttcggccaccatagttatgctggaatctatggtttattatccaagtgtcaa |
120 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |||||||| ||||||||| | | |||| ||||||||||||||| |
|
|
| T |
6416606 |
tattgcaagggaaggtcttcctttgacgaggtttaccctccgacattgttttggcccccatagttctgctggaatatttcgtttgttatccaagtgtcaa |
6416507 |
T |
|
| Q |
121 |
ggcttccaacatttggatcttgaacttccgtttctgaatgatcaacatgttgtccaattgtct |
183 |
Q |
| |
|
||| ||||||||||| ||||||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6416506 |
ggcatccaacatttgaatcttgaactttcgtttcttaatgatcaacatgttgtccaattgtct |
6416444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 150 - 185
Target Start/End: Original strand, 6588917 - 6588952
Alignment:
| Q |
150 |
gtttctgaatgatcaacatgttgtccaattgtcttc |
185 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6588917 |
gtttctgaatgatcaacatgttgtcgaattgtcttc |
6588952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 21 - 185
Target Start/End: Original strand, 13470191 - 13470355
Alignment:
| Q |
21 |
tattgcaagggcgggtcttcctttgacgaggtttaccctccgacattgtttcggccaccatagttatgctggaatctatggtttattatccaagtgtcaa |
120 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||||||||||||| |||| |||||||||||||||||| | | |||| ||||||||||||||| |
|
|
| T |
13470191 |
tattgcaagggaaggtcttcctttgacgaggtttgccctccgacattgttttggcccccatagttatgctggaatatttcgtttgttatccaagtgtcaa |
13470290 |
T |
|
| Q |
121 |
ggcttccaacatttggatcttgaacttccgtttctgaatgatcaacatgttgtccaattgtcttc |
185 |
Q |
| |
|
||| |||||||||| |||||||| ||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
13470291 |
ggcatccaacatttagatcttgagcttttgtttctgaatgatcaacatgttctccaattgtcttc |
13470355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 80 - 187
Target Start/End: Original strand, 21833896 - 21834006
Alignment:
| Q |
80 |
atagttatgctggaatctatggtttattatccaagtgtcaaggcttccaacatttggatcttgaacttcc---gtttctgaatgatcaacatgttgtcca |
176 |
Q |
| |
|
||||||||| |||||||| | |||| |||||||| |||| || |||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
21833896 |
atagttatgatggaatcttttgtttgttatccaaaggtcatggtgtccaacatttggatcttgaagataacatgtttctgaatgatcaacatgttgtcca |
21833995 |
T |
|
| Q |
177 |
attgtcttcat |
187 |
Q |
| |
|
|||| ||||| |
|
|
| T |
21833996 |
gttgtattcat |
21834006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 78 - 141
Target Start/End: Original strand, 19468015 - 19468078
Alignment:
| Q |
78 |
ccatagttatgctggaatctatggtttattatccaagtgtcaaggcttccaacatttggatctt |
141 |
Q |
| |
|
|||||| ||||||||||||| | |||| |||||||||||| ||| || ||||||||||||||| |
|
|
| T |
19468015 |
ccatagctatgctggaatcttttgtttgttatccaagtgtgcaggtttgcaacatttggatctt |
19468078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University