View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21163_high_60 (Length: 262)
Name: NF21163_high_60
Description: NF21163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21163_high_60 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 7 - 250
Target Start/End: Complemental strand, 35449810 - 35449567
Alignment:
| Q |
7 |
aatattgttttcaccgttttcactagattgtgtttttcatcggtatcaagtccnnnnnnnnn-cacaagtataataatttctgaactgaatttcattaaa |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35449810 |
aatattgttttcaccgttttcactagattgtgtttttcatcggtatcaagtccttttttttttcacaagtataataatttctgaactgaatttcattaaa |
35449711 |
T |
 |
| Q |
106 |
attctctttatttatctttgtttcttatgtgccacggtgcgcctaccataaaagagatatgatgacttttttcttcttgtatttgttttaatttctatca |
205 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
35449710 |
attctctttatttatctctggttcttatgtgccacggtgcgcctaccataaaagag-tatgatgacttttttctgcttgtattcgttttaatttctatca |
35449612 |
T |
 |
| Q |
206 |
ttctgaaaatttaaaatacatactcaatattctagagacatgata |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35449611 |
ttctgaaaatttaaaatacatactcaatattctatagacatgata |
35449567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University