View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21163_high_66 (Length: 249)
Name: NF21163_high_66
Description: NF21163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21163_high_66 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 34466358 - 34466596
Alignment:
| Q |
1 |
ttttggtttgaaatgggatggtaatgatactcaggtgagtaaaatggctcctcctgttccgccgccactgccgccgaggttatgggagactccggtggtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
34466358 |
ttttggtttgaaatgggatggtaatgatactcaggtgagtaaaatggctcctcctgttcccccgccgctgccgccgaggttatgggagactccggtggtg |
34466457 |
T |
|
| Q |
101 |
gtttctcaagatggtaatggtgatgttagtgttgagaatgaagaaaatttgaagccaaagttgaaggctttgcattgggataaagttaaggctagctcag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34466458 |
gtttctcaagatggtaatggtgatgttagtgttgagaatgaagaaaatttaaagccaaagttgaaggctttgcattgggataaagttaaggctagctcag |
34466557 |
T |
|
| Q |
201 |
atagggccatggtttgggatcaactgagaccaagttctt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34466558 |
atagggccatggtttgggatcaactgagaccaagttctt |
34466596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 155 - 222
Target Start/End: Complemental strand, 10326188 - 10326121
Alignment:
| Q |
155 |
ccaaagttgaaggctttgcattgggataaagttaaggctagctcagatagggccatggtttgggatca |
222 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| | |||||| || ||| | | |||||||||||||| |
|
|
| T |
10326188 |
ccaaagttgaagcctttgcattgggataaagtgagggctagttccgatcgtgaaatggtttgggatca |
10326121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University