View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21163_high_72 (Length: 239)
Name: NF21163_high_72
Description: NF21163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21163_high_72 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 19 - 239
Target Start/End: Original strand, 32940795 - 32941014
Alignment:
| Q |
19 |
atttggcaccacaacgtacaacttttttaggtttatatttgaggtccaaaatcacactgaaggnnnnnnngcacgtcgttcaacatctcgtgttattatc |
118 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| ||| |||| | ||||||||||||||||||||||||||||| |
|
|
| T |
32940795 |
atttggcaccacagcgtacaacttttttaggtttatatttgaggtccaaaattacagtgaaagaaaaaaa-cacgtcgttcaacatctcgtgttattatc |
32940893 |
T |
 |
| Q |
119 |
atcttatgagtggaatgactttacactaaatgtggttttggttcttagactagttgccttctatgttgttctctttttgacaagtgatttctctagatag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32940894 |
atcttatgagtggaatgactttacactaaatgtggttttggttcttagactagtcgccttctatgttgttctctttttgacaagtgatttctctagatag |
32940993 |
T |
 |
| Q |
219 |
aggaaatgacatttttgtttt |
239 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
32940994 |
aggaaatgacatttttgtttt |
32941014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University