View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21163_high_83 (Length: 228)

Name: NF21163_high_83
Description: NF21163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21163_high_83
NF21163_high_83
[»] chr1 (9 HSPs)
chr1 (1-210)||(41440454-41440663)
chr1 (1-62)||(27474377-27474438)
chr1 (1-52)||(45402193-45402244)
chr1 (1-63)||(4349735-4349797)
chr1 (1-46)||(4430015-4430060)
chr1 (1-62)||(42304207-42304268)
chr1 (1-62)||(46247953-46248014)
chr1 (2-46)||(33594147-33594191)
chr1 (2-62)||(43768237-43768297)
[»] scaffold0049 (1 HSPs)
scaffold0049 (1-65)||(59053-59117)
[»] chr5 (5 HSPs)
chr5 (2-62)||(3771414-3771474)
chr5 (1-62)||(25622534-25622595)
chr5 (1-64)||(12575658-12575721)
chr5 (1-62)||(16957388-16957449)
chr5 (1-62)||(38879657-38879718)
[»] chr4 (11 HSPs)
chr4 (11-62)||(6966175-6966226)
chr4 (3-62)||(36816384-36816443)
chr4 (1-64)||(44363128-44363191)
chr4 (1-67)||(20639653-20639719)
chr4 (1-63)||(38755907-38755969)
chr4 (1-67)||(50555651-50555717)
chr4 (1-62)||(10277757-10277818)
chr4 (2-63)||(30690175-30690236)
chr4 (1-62)||(51865038-51865099)
chr4 (2-54)||(19027923-19027975)
chr4 (1-69)||(33836480-33836548)
[»] chr8 (3 HSPs)
chr8 (1-62)||(35261753-35261814)
chr8 (1-52)||(44530223-44530274)
chr8 (1-62)||(35107311-35107372)
[»] chr7 (4 HSPs)
chr7 (9-46)||(3469191-3469228)
chr7 (2-61)||(18747562-18747621)
chr7 (1-46)||(33871926-33871971)
chr7 (2-46)||(45018939-45018983)
[»] chr6 (6 HSPs)
chr6 (1-62)||(6808469-6808530)
chr6 (9-62)||(13628256-13628309)
chr6 (1-52)||(18277203-18277254)
chr6 (1-62)||(12885987-12886048)
chr6 (1-62)||(13267799-13267860)
chr6 (1-62)||(29355855-29355916)
[»] chr2 (15 HSPs)
chr2 (1-46)||(99281-99326)
chr2 (1-66)||(14530394-14530459)
chr2 (1-62)||(44643597-44643658)
chr2 (1-45)||(19185760-19185804)
chr2 (93-125)||(33368890-33368922)
chr2 (11-62)||(11514519-11514570)
chr2 (170-205)||(33368827-33368862)
chr2 (1-67)||(10546237-10546303)
chr2 (1-62)||(9671253-9671314)
chr2 (1-62)||(10543774-10543835)
chr2 (1-42)||(32781308-32781349)
chr2 (1-42)||(33795359-33795400)
chr2 (5-69)||(17380231-17380294)
chr2 (1-45)||(31158456-31158500)
chr2 (1-61)||(40579750-40579810)
[»] chr3 (6 HSPs)
chr3 (2-58)||(19731099-19731155)
chr3 (9-62)||(10484616-10484669)
chr3 (1-62)||(13628790-13628851)
chr3 (1-62)||(40272812-40272873)
chr3 (1-62)||(53996565-53996626)
chr3 (1-62)||(54484787-54484848)
[»] scaffold0057 (1 HSPs)
scaffold0057 (1-68)||(46905-46972)


Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 9)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 41440663 - 41440454
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgccctttatttattttatttatttggtataatagaagaatctcaa 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |||||||||||||    
T  41440663 atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgccctttttttattttatttattcggtataagagaagaatctcaa 41440564  T
Q  101 atccaaaacttcacatacagcaaaacagaataaatacataaataaaagaaaccactatcaaacaaacagcagtttgattctacattttcctaagttcaat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
T  41440563 atccaaaacttcacatacagcaaaacagaataaatacataaataaaagaaatcactatcaaacaaacagcagtttgattctacattttcctaagttcaat 41440464  T
Q  201 gactagatac 210  Q
    ||||||||||    
T  41440463 gactagatac 41440454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 27474377 - 27474438
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt 62  Q
    ||||||| |||||||||  ||| ||| ||||||||||||||||||| |||||| ||||||||    
T  27474377 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgcccttt 27474438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 45402193 - 45402244
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccgg 52  Q
    ||||||| ||||||||| |||| ||| ||||||||||||||||||| |||||    
T  45402193 atggtgggaccccttcccagaccctgcgtatgcgggagctttagtgcaccgg 45402244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 4349735 - 4349797
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttta 63  Q
    ||||||| |||||||||  ||| ||| ||||||||||||||||||| |||||  |||||||||    
T  4349735 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttta 4349797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 4430060 - 4430015
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagtg 46  Q
    ||||||||||||||| || ||  |||||||||||||||||||||||    
T  4430060 atggtggaacccctttctggatcctgtgtatgcgggagctttagtg 4430015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 42304268 - 42304207
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt 62  Q
    ||||||| |||||||||  ||| ||| ||||| ||||||||||||| |||||| ||||||||    
T  42304268 atggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccggattgcccttt 42304207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 46248014 - 46247953
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt 62  Q
    ||||||| |||||||||  ||| ||| ||||||||||||||||||| |||||  ||||||||    
T  46248014 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgtaccgggttgcccttt 46247953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 2 - 46
Target Start/End: Complemental strand, 33594191 - 33594147
Alignment:
Q  2 tggtggaaccccttcctagactctgtgtatgcgggagctttagtg 46  Q
    |||||| ||||||||| |||| ||| |||||||||||||||||||    
T  33594191 tggtgggaccccttcccagaccctgcgtatgcgggagctttagtg 33594147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 2 - 62
Target Start/End: Original strand, 43768237 - 43768297
Alignment:
Q  2 tggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt 62  Q
    |||||| ||||||||| |||| ||| |||| ||||||||||| || ||||| |||||||||    
T  43768237 tggtgggaccccttcccagaccctgcgtatacgggagctttaatgcaccgggctgcccttt 43768297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0049 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0049
Description:

Target: scaffold0049; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 59053 - 59117
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgccctttatt 65  Q
    ||||||| ||||||||| |||||||| ||||||||||||||||||| | |||  |||||||||||    
T  59053 atggtgggaccccttcccagactctgcgtatgcgggagctttagtgcatcgggttgccctttatt 59117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 37; Significance: 0.000000000005; HSPs: 5)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 2 - 62
Target Start/End: Original strand, 3771414 - 3771474
Alignment:
Q  2 tggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt 62  Q
    |||||| |||||||||  ||||||||||||| ||||||||||||| ||||| |||||||||    
T  3771414 tggtgggaccccttcccggactctgtgtatgtgggagctttagtgcaccgggctgcccttt 3771474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 25622534 - 25622595
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt 62  Q
    ||||||| |||||||||  ||| ||| ||||||||||||||||||| |||||| ||||||||    
T  25622534 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgcccttt 25622595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 12575721 - 12575658
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgccctttat 64  Q
    ||||||| |||||||||| ||| ||| |||||| |||||||| ||| ||||| |||||||||||    
T  12575721 atggtgggaccccttcctggaccctgcgtatgcaggagctttggtgcaccgggctgccctttat 12575658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 16957388 - 16957449
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt 62  Q
    ||||||| |||||||||  ||| ||| ||||||||||||||||||| |||||  ||||||||    
T  16957388 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 16957449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 38879657 - 38879718
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt 62  Q
    ||||||| |||||||||  ||| ||| ||||||||||||||||||| |||||  ||||||||    
T  38879657 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 38879718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 11)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 11 - 62
Target Start/End: Original strand, 6966175 - 6966226
Alignment:
Q  11 cccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt 62  Q
    |||||||  |||||||||||||| ||||| ||||||||||||||||||||||    
T  6966175 cccttcccggactctgtgtatgcaggagcattagtgaaccggactgcccttt 6966226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 3 - 62
Target Start/End: Complemental strand, 36816443 - 36816384
Alignment:
Q  3 ggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt 62  Q
    ||||| || ||||||| ||| ||||||||||||||||||||||| |||||  ||||||||    
T  36816443 ggtgggactccttcctggaccctgtgtatgcgggagctttagtgtaccgggttgcccttt 36816384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 44363191 - 44363128
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgccctttat 64  Q
    ||||||| |||||||||  ||| ||| ||||||||||||||||||| |||||  ||||||||||    
T  44363191 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttat 44363128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 20639719 - 20639653
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgccctttattta 67  Q
    ||||||| |||||||||  ||| ||| ||||||||||||||||||| |||||  |||||||| ||||    
T  20639719 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttttta 20639653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 38755969 - 38755907
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttta 63  Q
    ||||||| |||||||||  ||| ||| ||||||||||||||||||| |||||  |||||||||    
T  38755969 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttta 38755907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 50555717 - 50555651
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgccctttattta 67  Q
    |||||||||||||||||  ||| ||| |||||| |||| ||||||| ||||| ||||||||| ||||    
T  50555717 atggtggaaccccttcccggaccctgcgtatgcaggagttttagtgcaccgggctgcccttttttta 50555651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 10277818 - 10277757
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt 62  Q
    |||||| |||||||||| |||| |||  |||||||||| | |||||||||||| ||||||||    
T  10277818 atggtgaaaccccttcccagaccctgcatatgcgggagttctagtgaaccggattgcccttt 10277757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 2 - 63
Target Start/End: Complemental strand, 30690236 - 30690175
Alignment:
Q  2 tggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttta 63  Q
    |||||| |||||||||  ||| ||| ||||||||||||||||||| ||| | ||||||||||    
T  30690236 tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggctgcccttta 30690175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 51865099 - 51865038
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt 62  Q
    |||||||  ||||||||  ||| ||| |||||||||||||||| || |||||||||||||||    
T  51865099 atggtggggccccttcccggaccctgcgtatgcgggagctttattgcaccggactgcccttt 51865038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 2 - 54
Target Start/End: Original strand, 19027923 - 19027975
Alignment:
Q  2 tggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggac 54  Q
    |||||| ||||||| | |||||||| ||||| ||||||||||||| |||||||    
T  19027923 tggtgggacccctttccagactctgcgtatgtgggagctttagtgcaccggac 19027975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 33836548 - 33836480
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgccctttatttatt 69  Q
    ||||||| |||||||||  ||| ||| ||||||||||||||||||| | |||  |||||||| ||||||    
T  33836548 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggttgccctttttttatt 33836480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 35261753 - 35261814
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt 62  Q
    ||||||| |||||||||| ||| ||| ||||||||||||||||||| |||||  ||||||||    
T  35261753 atggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 35261814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 44530223 - 44530274
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccgg 52  Q
    ||||||| |||||||||| ||| ||| ||||||||||||||||||| |||||    
T  44530223 atggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgg 44530274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 35107372 - 35107311
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt 62  Q
    ||||||| |||||||||  ||| |||||||||||| |||||||||| |||||  ||||||||    
T  35107372 atggtgggaccccttcccggacgctgtgtatgcggaagctttagtgcaccgggttgcccttt 35107311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 9 - 46
Target Start/End: Complemental strand, 3469228 - 3469191
Alignment:
Q  9 accccttcctagactctgtgtatgcgggagctttagtg 46  Q
    |||||||||||||| |||||||||||||||||||||||    
T  3469228 accccttcctagaccctgtgtatgcgggagctttagtg 3469191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 2 - 61
Target Start/End: Original strand, 18747562 - 18747621
Alignment:
Q  2 tggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgccctt 61  Q
    |||||| ||||||||||  || ||| ||||||||||||||||||| ||||| ||||||||    
T  18747562 tggtgggaccccttcctgaaccctgcgtatgcgggagctttagtgcaccgggctgccctt 18747621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 33871971 - 33871926
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagtg 46  Q
    ||||||| ||||||||| |||| ||||||||||| |||||||||||    
T  33871971 atggtgggaccccttcccagaccctgtgtatgcgagagctttagtg 33871926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 2 - 46
Target Start/End: Complemental strand, 45018983 - 45018939
Alignment:
Q  2 tggtggaaccccttcctagactctgtgtatgcgggagctttagtg 46  Q
    ||||||||||||||||  ||| ||| |||||||||||||||||||    
T  45018983 tggtggaaccccttcccggaccctgcgtatgcgggagctttagtg 45018939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 6)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 6808469 - 6808530
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt 62  Q
    ||||||| |||||||||  ||| ||||||||||||||||||||||| |||||  ||||||||    
T  6808469 atggtgggaccccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgcccttt 6808530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 9 - 62
Target Start/End: Complemental strand, 13628309 - 13628256
Alignment:
Q  9 accccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt 62  Q
    |||||||||||||||||| ||||||||||| ||||||| || ||| ||||||||    
T  13628309 accccttcctagactctgcgtatgcgggagttttagtgcactggattgcccttt 13628256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 18277254 - 18277203
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccgg 52  Q
    ||||||| |||||||||||||||||  |||||||||||||||| || |||||    
T  18277254 atggtgggaccccttcctagactctacgtatgcgggagctttactgcaccgg 18277203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 12885987 - 12886048
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt 62  Q
    ||||||| ||||||||| |||| ||| ||||| ||||||||||||| |||||  ||||||||    
T  12885987 atggtgggaccccttcccagaccctgcgtatgtgggagctttagtgcaccgggttgcccttt 12886048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 13267799 - 13267860
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt 62  Q
    ||||||| |||||||||| ||| ||| |||||||||||||| |||| |||||  ||||||||    
T  13267799 atggtgggaccccttcctggaccctgcgtatgcgggagcttcagtgcaccgggttgcccttt 13267860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 29355916 - 29355855
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt 62  Q
    ||||||| |||||||||  ||| ||| ||||||||||||||||||| |||||  ||||||||    
T  29355916 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 29355855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 15)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 99326 - 99281
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagtg 46  Q
    ||||||||||||||||  |||| |||||||||||||||||||||||    
T  99326 atggtggaaccccttctcagaccctgtgtatgcgggagctttagtg 99281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 14530394 - 14530459
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgccctttattt 66  Q
    ||||||| |||||||||  ||| ||| ||||||||||||||||||| |||||  ||||||||||||    
T  14530394 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttattt 14530459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 44643597 - 44643658
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt 62  Q
    ||||||| ||||||||| |||| ||| |||||||||||| |||||| ||||| |||||||||    
T  44643597 atggtgggaccccttcccagaccctgcgtatgcgggagccttagtgcaccgggctgcccttt 44643658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 19185804 - 19185760
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagt 45  Q
    |||||||||||||||||| ||| ||| ||||||||||||||||||    
T  19185804 atggtggaaccccttcctggaccctgcgtatgcgggagctttagt 19185760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 93 - 125
Target Start/End: Complemental strand, 33368922 - 33368890
Alignment:
Q  93 aatctcaaatccaaaacttcacatacagcaaaa 125  Q
    |||||||||||||||||||||||||||||||||    
T  33368922 aatctcaaatccaaaacttcacatacagcaaaa 33368890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 11 - 62
Target Start/End: Original strand, 11514519 - 11514570
Alignment:
Q  11 cccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt 62  Q
    ||||||| |||| ||| ||||||||||||||||||| |||||| ||||||||    
T  11514519 cccttcccagaccctgcgtatgcgggagctttagtgcaccggattgcccttt 11514570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 33368862 - 33368827
Alignment:
Q  170 cagtttgattctacattttcctaagttcaatgacta 205  Q
    ||||||||||||||||||||| ||||||||||||||    
T  33368862 cagtttgattctacattttcccaagttcaatgacta 33368827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 67
Target Start/End: Original strand, 10546237 - 10546303
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgccctttattta 67  Q
    ||||||| |||||||||  ||| ||| ||||||||||||||||||| |||||  |||||||| ||||    
T  10546237 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttttta 10546303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 9671253 - 9671314
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt 62  Q
    ||||||| |||||||||  ||| ||| ||||||||||||||||||| |||||  ||||||||    
T  9671253 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 9671314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 10543774 - 10543835
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt 62  Q
    ||||||| |||||||||  ||| ||| ||||||||||||||||||| |||||  ||||||||    
T  10543774 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 10543835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 32781349 - 32781308
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagcttt 42  Q
    ||||||| ||||||||| |||| |||||||||||||||||||    
T  32781349 atggtgggaccccttcccagaccctgtgtatgcgggagcttt 32781308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 33795359 - 33795400
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagcttt 42  Q
    ||||||| ||||||||| |||| |||||||||||||||||||    
T  33795359 atggtgggaccccttcccagaccctgtgtatgcgggagcttt 33795400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 69
Target Start/End: Complemental strand, 17380294 - 17380231
Alignment:
Q  5 tggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgccctttatttatt 69  Q
    |||||||||||||| ||| ||| | ||||||||||||| ||| ||||| || |||||||||||||    
T  17380294 tggaaccccttcctggaccctgcggatgcgggagcttt-gtgcaccgggcttccctttatttatt 17380231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 31158500 - 31158456
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagt 45  Q
    ||||||| ||||||||| |||| ||| ||||||||||||||||||    
T  31158500 atggtgggaccccttcccagaccctgcgtatgcgggagctttagt 31158456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 40579810 - 40579750
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgccctt 61  Q
    ||||||| |||||||||  ||| ||| ||||||||||||||||||| |||||  |||||||    
T  40579810 atggtgggaccccttcccggaccctgagtatgcgggagctttagtgcaccgggttgccctt 40579750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 6)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 2 - 58
Target Start/End: Original strand, 19731099 - 19731155
Alignment:
Q  2 tggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcc 58  Q
    |||||| |||| |||| ||||||||||||||| |||||||||||| ||||| |||||    
T  19731099 tggtgggaccctttcccagactctgtgtatgcaggagctttagtgcaccgggctgcc 19731155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 9 - 62
Target Start/End: Complemental strand, 10484669 - 10484616
Alignment:
Q  9 accccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt 62  Q
    |||||||||| ||| ||| ||||||||||||||||||| |||||  ||||||||    
T  10484669 accccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 10484616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 13628851 - 13628790
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt 62  Q
    ||||||| |||||||||  ||| ||| ||||||||||||||||||| |||||  ||||||||    
T  13628851 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 13628790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 40272873 - 40272812
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt 62  Q
    ||||||| |||||||||  ||| ||| ||||||||||||||||||| |||||  ||||||||    
T  40272873 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 40272812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 53996626 - 53996565
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt 62  Q
    ||||||| |||||||||  ||| ||| ||||| ||||||||||||| ||||| |||||||||    
T  53996626 atggtgggaccccttccctgacactgcgtatgtgggagctttagtgcaccgggctgcccttt 53996565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 54484787 - 54484848
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttt 62  Q
    ||||||| |||||||||  ||| ||| ||||||||||||||||||| |||||  ||||||||    
T  54484787 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 54484848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0057
Description:

Target: scaffold0057; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 46905 - 46972
Alignment:
Q  1 atggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgccctttatttat 68  Q
    ||||||| |||||||||  ||| ||| ||||||||||||||||||| |||||  |||||||| |||||    
T  46905 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttttttat 46972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University