View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21163_high_87 (Length: 223)
Name: NF21163_high_87
Description: NF21163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21163_high_87 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 17 - 205
Target Start/End: Complemental strand, 9533075 - 9532886
Alignment:
| Q |
17 |
aaaatcatcataatctatactaaaaaa-tattatatccaagaatatatatggataagaggaagaaattgcaagagtcttttcaaccttaaaaatgagtgt |
115 |
Q |
| |
|
|||||||| ||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9533075 |
aaaatcattatagtctatactaaaaaaatattatatccaagaatatatatggataagaggaagaaattgcaagagtcttttcaaccttaaaaacgagtgt |
9532976 |
T |
|
| Q |
116 |
taaatctcttaaaaataaacttttccttttgatgtgattttatcgaactaaaaaattaatccttgcagctacacgcagaagatacatagt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |||||| |||||||||||| |
|
|
| T |
9532975 |
taaatctcttaaaaataaacttttccttttgatgtgattttattcaactaaaaaattaatgcttgcagctgcacgcaaaagatacatagt |
9532886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University