View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21163_high_87 (Length: 223)

Name: NF21163_high_87
Description: NF21163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21163_high_87
NF21163_high_87
[»] chr7 (1 HSPs)
chr7 (17-205)||(9532886-9533075)


Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 17 - 205
Target Start/End: Complemental strand, 9533075 - 9532886
Alignment:
17 aaaatcatcataatctatactaaaaaa-tattatatccaagaatatatatggataagaggaagaaattgcaagagtcttttcaaccttaaaaatgagtgt 115  Q
    |||||||| ||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
9533075 aaaatcattatagtctatactaaaaaaatattatatccaagaatatatatggataagaggaagaaattgcaagagtcttttcaaccttaaaaacgagtgt 9532976  T
116 taaatctcttaaaaataaacttttccttttgatgtgattttatcgaactaaaaaattaatccttgcagctacacgcagaagatacatagt 205  Q
    |||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||| ||||||||| |||||| ||||||||||||    
9532975 taaatctcttaaaaataaacttttccttttgatgtgattttattcaactaaaaaattaatgcttgcagctgcacgcaaaagatacatagt 9532886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University