View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21163_low_48 (Length: 305)
Name: NF21163_low_48
Description: NF21163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21163_low_48 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 65 - 286
Target Start/End: Original strand, 52547574 - 52547795
Alignment:
| Q |
65 |
ttaagagaactaaccgggagaccgacagcaacactaagcaaagagatcttgttatttccaacccttagcttaacgttcttactaaatgtcaatttaggaa |
164 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
52547574 |
ttaagagaactaaccaggagaccgacagcaacactaagcaaagagatcttgttatttccaacccttagcttaacattcttactaaatgtcaatttaggaa |
52547673 |
T |
|
| Q |
165 |
actctaatgatccatacacagaacctgccttcatacaggaaatggataagtaaaactatagtttgttacagaagnnnnnnngtactaaaacaaaaatata |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
52547674 |
actctaatgatccatacacagaacctgccttcatacaggaaatggataagtaaaactatagtttgttacagaagaaaaaaagtactaaaacaaaaatata |
52547773 |
T |
|
| Q |
265 |
attgactaattttattgacctg |
286 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
52547774 |
attgactaattttattgacctg |
52547795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 72 - 181
Target Start/End: Complemental strand, 17128263 - 17128154
Alignment:
| Q |
72 |
aactaaccgggagaccgacagcaacactaagcaaagagatcttgttatttccaacccttagcttaacgttcttactaaatgtcaatttaggaaactctaa |
171 |
Q |
| |
|
||||||||| |||||||| ||||||||||| | ||| ||||||||||| |||||||| | ||| ||| | || |||||||||||||||||| || || |
|
|
| T |
17128263 |
aactaaccgaaagaccgacggcaacactaagtagagaaatcttgttattgccaaccctcaacttcacgctgttgctaaatgtcaatttaggattgtccaa |
17128164 |
T |
|
| Q |
172 |
tgatccatac |
181 |
Q |
| |
|
|||||||||| |
|
|
| T |
17128163 |
tgatccatac |
17128154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 73 - 120
Target Start/End: Complemental strand, 5232307 - 5232260
Alignment:
| Q |
73 |
actaaccgggagaccgacagcaacactaagcaaagagatcttgttatt |
120 |
Q |
| |
|
||||||||| ||||| |||||||||||||| ||||| ||||||||||| |
|
|
| T |
5232307 |
actaaccggaagacccacagcaacactaagtaaagaaatcttgttatt |
5232260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University