View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21163_low_49 (Length: 304)
Name: NF21163_low_49
Description: NF21163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21163_low_49 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 11 - 264
Target Start/End: Complemental strand, 25566295 - 25566035
Alignment:
| Q |
11 |
cacagaccacaatccaatgttccaatgtttattgttcaaactagacaaactagatttggtttatccattccatttgcaaacaataacatcatcaccacat |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
25566295 |
cacacaccacaatccaatgttccaatgtttattgttcaaactagacaaactagatttggtttatccgttccatttgcaaacaataacatcatcaccacat |
25566196 |
T |
 |
| Q |
111 |
gacacaatattacatccttggatatgcctagcatggcttcccctcttctgctcccactttgtaagtcctttcactttctcttttcctcactatccaaaaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
25566195 |
gacacaatattacatccttggatatgcctagcatggcttcccctcttctgcttccactttgtaagtcctttcactttctctcttcctcactgtccaaaaa |
25566096 |
T |
 |
| Q |
211 |
tgcataatattgtgtgattgctgtaatcaa-------gttaatttatatttgatttgttcc |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25566095 |
tgcataatattgtgtgattgctgtaatcaagttcactgttaatttatatttgatttgttcc |
25566035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University