View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21163_low_56 (Length: 274)
Name: NF21163_low_56
Description: NF21163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21163_low_56 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 9e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 14 - 157
Target Start/End: Complemental strand, 44166342 - 44166199
Alignment:
| Q |
14 |
cagagagcaagaataggcaaagattacgtggcggctaagatcctttgctgacttttttgttgcaaaagtagatagaaacagaaaagagagacacaaacat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44166342 |
cagagagcaagaataggcaaagattacgtggcggctaagatcctttgctgacttttttgttgcaaaagtagatagaaacagaaaagagagacacaaacat |
44166243 |
T |
 |
| Q |
114 |
ggctactttgaatgttttctctcaaccattgcaccctacaacta |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44166242 |
ggctactttgaatgttttctctcaaccattgcaccctacaacta |
44166199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University