View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21163_low_57 (Length: 273)
Name: NF21163_low_57
Description: NF21163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21163_low_57 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 18 - 266
Target Start/End: Original strand, 25796668 - 25796916
Alignment:
| Q |
18 |
ctcaatagtgcagtgatgtcaacnnnnnnngttttactcaaacaagctagggcatttcattcataataatagtgaatacaatttgaaatactcgtaaaag |
117 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25796668 |
ctcaatagtgccgtgatgtcaactttttttgttttactcaaacaagctagggcatttcattcataataatagtgaatacaatttgaaatactcgtaaaag |
25796767 |
T |
 |
| Q |
118 |
tactatcaggagtgtaaaagatagatgttctagctagactatgaagtatgaaaactacccttagttgatcgcctagagaaaacgactctatagttgttga |
217 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
25796768 |
tactgtcaggagtgtaaaagatagatgctctagctagactatgaagtatgaacactacccttagttgatcgccaagagaaaactactctatagttgttga |
25796867 |
T |
 |
| Q |
218 |
acgattgaaggaaacctctgcatttttcaatgaggcagccatattcttg |
266 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
25796868 |
acgattgaaggaaacctctgcacttttcaatgaggcagccatattcttg |
25796916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University