View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21163_low_67 (Length: 249)
Name: NF21163_low_67
Description: NF21163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21163_low_67 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 43055041 - 43054798
Alignment:
| Q |
1 |
tttcctgcaacagaaaacataaacattgaacatgatcagcagtatacatttatacagaagtcataaacataactgaaactgggtaattttctagggacta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43055041 |
tttcctgcaacagaaaacataaacattgaacatgatcagcagtatacatttatacagaagtcataaacataaccgaaactgggtaattttctagggacta |
43054942 |
T |
|
| Q |
101 |
aacatatgcatccctagccaattgtgcccgtctggacgccagaaataataacagcaataataataataacaactgtatttgacctagcaactatcatatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43054941 |
aacatatgcatccctagccaattgtgcccgtctggacgccagaaataataacagtaataataataataacaactgtatttgacctagcaactatcatatt |
43054842 |
T |
|
| Q |
201 |
ctggatccataacgtaaagaattgtcactaaatattttcttgga |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43054841 |
ctggatccataacgtaaagaattgtcactaaatattttgttgga |
43054798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University