View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21163_low_71 (Length: 247)
Name: NF21163_low_71
Description: NF21163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21163_low_71 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 17 - 231
Target Start/End: Original strand, 34364721 - 34364938
Alignment:
| Q |
17 |
atttataatacatttgtttaggtttctttctgttattacatcaattattct---ataacaaacatagtatgacacaagtggtatatacttaaatctttta |
113 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34364721 |
atttataatacatttgtctaggtttctttccgttattacatcaattattcttccataacaaacatagtatgacacaagtggtagatacttaaatctttta |
34364820 |
T |
 |
| Q |
114 |
actatttgatttagagttcgattttactcgacataatataggagttaataaatgatcaaccgtaaaattatgaagaaccaaaatggatcaatgttttcca |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
34364821 |
actatttgatttagagttcgattttactcgacataatataggagttaataaatgatcaaccgtaaaattatgaagaatcaaaatggatctatgttttcca |
34364920 |
T |
 |
| Q |
214 |
gatgtttgttcaatttcg |
231 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
34364921 |
gatgtttgttcaatttcg |
34364938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University