View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21163_low_73 (Length: 247)
Name: NF21163_low_73
Description: NF21163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21163_low_73 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 5e-77; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 86 - 243
Target Start/End: Complemental strand, 7832281 - 7832124
Alignment:
| Q |
86 |
atgcttccccaaaacctccctttgttcggtttgataatgttgggacaagagagtgtgaagtttgggttcccttttcagagtaagggatttgtattacttt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7832281 |
atgcttccccaaaacctccctttgttcggattgataatgttgggacaagagagtgtgaagtttgggttcccttttcagactaagggatttgtattacttt |
7832182 |
T |
|
| Q |
186 |
tgaaggaataaaaggttcctatgtttgaaatagtttcaaaaagattggtctgtgatgc |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7832181 |
tgaaggaataaaaggttcctatgtttgaaatagtttcaaaaagattggtctctgatgc |
7832124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 7832344 - 7832285
Alignment:
| Q |
1 |
ttgaatattgcccctcctagcgagagatgggtttgtttttgggttgccgaggagcctttg |
60 |
Q |
| |
|
||||||||||| ||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7832344 |
ttgaatattgctcctcctagcaagagatgggtgcgtttttgggttgccgaggagcctttg |
7832285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University