View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21163_low_74 (Length: 244)
Name: NF21163_low_74
Description: NF21163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21163_low_74 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 16 - 205
Target Start/End: Complemental strand, 36285898 - 36285709
Alignment:
| Q |
16 |
atcagccctagaaagccaaagcaattaatcatctttattgcaataaacccattgtttttatgattatccctgacccttcaaaaacagcagcgctccatag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36285898 |
atcagccctagaaagccaaagcaattaatcatctttattgcaataaacccattgtttttatgattatccctgacccttcaaaaacagcagcgctccatag |
36285799 |
T |
|
| Q |
116 |
ttctttttatggaagccacaagaagttatacacttcaaaagggatgattatgacnnnnnnnattacaagtattgaaacacaaacactata |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36285798 |
ttctttttatggaagccacaagaagttatacacttcaaaagggatgattatgactttttttattacaagtattgaaacacaaacactata |
36285709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University