View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21163_low_87 (Length: 228)
Name: NF21163_low_87
Description: NF21163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21163_low_87 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 94 - 228
Target Start/End: Original strand, 31165940 - 31166074
Alignment:
| Q |
94 |
taatattaaatgtagtacaagcaagcaataagacagtcatatgaattttatgattttcacaaaaccgacaaattaccaagaaatgttcttgaaacttctc |
193 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31165940 |
taatattaaatgtagtacaagaaagcaataagacagtcatatgaattttatgattttcacaaaaccgacaaattaccaagaaatgttcttgaaacttctc |
31166039 |
T |
|
| Q |
194 |
aaagtgcatattcgaataaaatgggataagccaaa |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
31166040 |
aaagtgcatattcgaataaaatgggataagccaaa |
31166074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University