View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21164_low_18 (Length: 207)
Name: NF21164_low_18
Description: NF21164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21164_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 56277595 - 56277787
Alignment:
| Q |
1 |
tgctgccgtacctgttttccttctccaaatccaaccatctatctctgtaatccttcaaacaaagactggattcaattcaactgccctcctcaatgtcaca |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||| ||| |
|
|
| T |
56277595 |
tgctgccgtacctgttttccttccccaaatccaaccatctatctctgcaatccttcaaacaaagactttattcaattcaactgccctcctcaatgtgaca |
56277694 |
T |
 |
| Q |
101 |
ttactgatagcatagctcttgc------------ttttgattttgacccttccaaattcaaattcaaattggtaagggtgaaacgcattcagaagtatc |
187 |
Q |
| |
|
| |||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56277695 |
taactgatagcatagctcttgcttttgattttgattttgattttgacccttc------caaattcaaattggtaagggtgaaacgcattcagaagtatc |
56277787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University