View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21165_high_18 (Length: 444)

Name: NF21165_high_18
Description: NF21165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21165_high_18
NF21165_high_18
[»] chr1 (1 HSPs)
chr1 (75-277)||(7079950-7080152)


Alignment Details
Target: chr1 (Bit Score: 155; Significance: 4e-82; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 155; E-Value: 4e-82
Query Start/End: Original strand, 75 - 277
Target Start/End: Complemental strand, 7080152 - 7079950
Alignment:
75 atttgttcgtcgtcgttttggtggattgtggtgttgtttaagtgggttttgagtgatgggtcgattagtgaagtgctggattcatatgaatggaaatgaa 174  Q
    |||| ||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||| |||||| ||||| |    
7080152 atttcttcatcgtcgttttggtggattgtggtgtcgtttaagtgggttttgagtgatgggtcgatcagtgaagtgctggattcatgtgaatgaaaatgga 7080053  T
175 gagttcggtgagtgatgattgatgaagaaatgggtaattgcttgaagagggttttggagaattgggaatttgagattgatttgagtttcgatagggtctg 274  Q
    ||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| | |||||| ||    
7080052 gagttcggtgagtgatgattgatgatgaaatgggtaattgtttgaagagggttttggagaattgggaatttgagattgatttgagtttggttagggtttg 7079953  T
275 ttt 277  Q
    |||    
7079952 ttt 7079950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University