View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21165_high_20 (Length: 425)
Name: NF21165_high_20
Description: NF21165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21165_high_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 380; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 380; E-Value: 0
Query Start/End: Original strand, 19 - 410
Target Start/End: Original strand, 30873881 - 30874272
Alignment:
| Q |
19 |
gtagaaacgatccggacaaagaaagtatttcaaaccttccgtgtaaagtcactacagatcctgcggcagctggctgtcgcagggtcacgttagtgactgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30873881 |
gtagaaacgatccggacaaagaaagtatttcaaaccttccatgtaaagtcactacagatcctgcggcagctggctgtcgcaaggtcacgttagtgactgt |
30873980 |
T |
 |
| Q |
119 |
tccactcccactaaggacacagatccctctttgacgctttcttgcataggtagccacagagtcaaacacatcacaaccactacttacttcaaggatgtga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30873981 |
tccactcccactaaggacacagatccctctttgacgctttcttgcataagtagccacagagtcaaacacatcacaaccactacttacttcaaggatgtga |
30874080 |
T |
 |
| Q |
219 |
gccctaagtgtgtttgcactctctcttgtgatgatcaccggtggtttaggtttgttctttgagcccggaggtcttcccctcggcctgcgaccaactacat |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30874081 |
gccctaagtgtgtttgcactctctcttgtgatgatcaccggtggtttaggtttgttctttgagcccggaggtcttcccctcggcctgcgaccaactacat |
30874180 |
T |
 |
| Q |
319 |
ctccaagaccatgatttggtgaaactaggtcaagcccttcatggttattgttgttgtttccatcttggtcttgactctcatcatgaacttct |
410 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30874181 |
ctccaagaccatgatttggtgaaactaggtcaagcccttcatggttattgttgttgtttccatcttggtcttgactctcatcatgaacttct |
30874272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 204 - 265
Target Start/End: Complemental strand, 40541580 - 40541519
Alignment:
| Q |
204 |
acttcaaggatgtgagccctaagtgtgtttgcactctctcttgtgatgatcaccggtggttt |
265 |
Q |
| |
|
|||||||| || ||||| || || ||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
40541580 |
acttcaagaatatgagctctgagagtgttggcactctctcgagtgatgatcaccggtggttt |
40541519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University