View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21165_high_46 (Length: 297)
Name: NF21165_high_46
Description: NF21165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21165_high_46 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 11 - 278
Target Start/End: Original strand, 47127729 - 47127995
Alignment:
| Q |
11 |
cagagatagccgatgaacgattgcagtattggatcgatcataactctaagacacctacctcacaagacgcagttgacggtattgtcaatctcattcatcc |
110 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || |
|
|
| T |
47127729 |
cagagatagccgatgagcgattgcagtattggatcgatcataactctaagacacctacctcacaagatgcagttgacggtattgtcaatctcattcaccc |
47127828 |
T |
 |
| Q |
111 |
tatatattttagtttgattcaaatcttaatcactattacagtataggttccatcatatcgacnnnnnnnnctgaaaattaagacaatatttacctatttt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
47127829 |
tatatattttagtttgattcaaatcttaatcactattacagtataggttccatcatatcgac-tttttttctgaaaattaagacaatatttacctatttt |
47127927 |
T |
 |
| Q |
211 |
agttctgtctcactatttaaacataacttgtattttgtacttttacattgcacaataaataatcgtga |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
47127928 |
agttctgtctcactatttaaacataacttgtattttgtacttttacattgcacaataaaaaatcgtga |
47127995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University