View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21165_high_52 (Length: 263)
Name: NF21165_high_52
Description: NF21165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21165_high_52 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 40 - 263
Target Start/End: Original strand, 51908904 - 51909129
Alignment:
| Q |
40 |
ctttttgcattgtcctc--ggaatatttttaatgcaagttacattattttctactagtgaaagtgttgtgttgccttccatatctgctgatcatgtattc |
137 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51908904 |
ctttttgcattgtcctcttggaatatttttaatgcaagttacattattttctactagtgaaagtgttgtgttgccttccatatctgctgatcatgtattc |
51909003 |
T |
 |
| Q |
138 |
tggtccaactgcatttacaggtttcagtctcagttttctattttttcttgacacttttgaaattacagcttctgaatataagctcctttttaaacacagt |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51909004 |
tggtccaactgcatttacaggtttcagtctcagttttctattttttcttgacacttttgaaattacagcttctgaatataagctcctttttaaacacagt |
51909103 |
T |
 |
| Q |
238 |
tttagtcaattcttttttaatgcaaa |
263 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
51909104 |
tttagtcaattcttttttaatgcaaa |
51909129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University