View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21165_high_60 (Length: 237)

Name: NF21165_high_60
Description: NF21165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21165_high_60
NF21165_high_60
[»] chr7 (3 HSPs)
chr7 (1-221)||(2626159-2626379)
chr7 (36-217)||(8295067-8295248)
chr7 (32-141)||(27727547-27727656)
[»] chr6 (1 HSPs)
chr6 (1-222)||(15907368-15907590)
[»] chr4 (1 HSPs)
chr4 (81-214)||(18285656-18285789)
[»] scaffold0023 (1 HSPs)
scaffold0023 (81-217)||(138676-138812)
[»] chr2 (1 HSPs)
chr2 (126-194)||(27362221-27362289)
[»] chr1 (1 HSPs)
chr1 (36-172)||(22162282-22162418)


Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 2626159 - 2626379
Alignment:
1 cttttaatcttggcttaggaaactcactcactgctgagcttaatggagccatgataacaatataattggattctcaaaagggttggaatcacttatggat 100  Q
    ||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2626159 cttttaatcttggcttaggaaactccctcactgctaagcttaatggagccatgataacaatataattggattctcaaaagggttggaatcacttatggat 2626258  T
101 tgaaacaggctcaatgttagtcactttggctttcaagtctaaatccattgtgccttggcacttaaggaataggtgggataactgtttacatttactctcc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2626259 tgaaacaggctcaatgttagtcactttggctttcaagtctaaatccattgtgccttggcacttaaggaataggtgggataactgtttacatttactctcc 2626358  T
201 tcaatgtcttttattgtttct 221  Q
    |||||| ||||||||||||||    
2626359 tcaatgccttttattgtttct 2626379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 36 - 217
Target Start/End: Complemental strand, 8295248 - 8295067
Alignment:
36 gagcttaatggagccatgataacaatataattggattctcaaaagggttggaatcacttatggattgaaacaggctcaatgttagtcactttggctttca 135  Q
    ||||||||||||||||||||  ||||  |||| | |||||||||||| ||| ||||| | ||| | |||||||  || ||||| || |||   |||||||    
8295248 gagcttaatggagccatgatggcaattgaattcgcttctcaaaaggggtggcatcacctttggctagaaacagattctatgttggtaactgcagctttca 8295149  T
136 agtctaaatccattgtgccttggcacttaaggaataggtgggataactgtttacatttactctcctcaatgtcttttattgt 217  Q
    ||||||   | || || |||||||||||||| ||||| ||| | || ||||| ||| |   |||||| ||||||||| ||||    
8295148 agtctatcacgatcgttccttggcacttaagaaatagatggcaaaattgttttcatctctgctcctctatgtctttttttgt 8295067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 32 - 141
Target Start/End: Original strand, 27727547 - 27727656
Alignment:
32 tgctgagcttaatggagccatgataacaatataattggattctcaaaagggttggaatcacttatggattgaaacaggctcaatgttagtcactttggct 131  Q
    ||||||||||||||||||||||||  ||||  |||| | |||||||||||| ||| ||||| | ||| | |||||||  || ||||| || |||   |||    
27727547 tgctgagcttaatggagccatgatggcaattgaattcgcttctcaaaaggggtggcatcacctttggctagaaacagattctatgttggtaactgcagct 27727646  T
132 ttcaagtcta 141  Q
    ||||||||||    
27727647 ttcaagtcta 27727656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 15907590 - 15907368
Alignment:
1 cttttaatcttggcttaggaaactcactcactgctgagcttaatggagccatgataacaatataattggattctcaaaagggttggaatcacttatggat 100  Q
    |||||||||||||| |||| || |||||||||||| |||| |||||||| ||| || ||||| |  ||| ||||||||| |||||||||||||||| |||    
15907590 cttttaatcttggcataggcaattcactcactgctaagctcaatggagctatggtagcaatagagatggcttctcaaaaaggttggaatcacttattgat 15907491  T
101 tgaaacaggctcaatgttagtcactttggctttcaagtc-taaatccattgtgccttggcacttaaggaataggtgggataactgtttacatttactctc 199  Q
    ||||||||  |||||| |||| ||  ||||||| |||||  ||| ||||||| | |||| |  |||||||||| |||||||| |||||||| ||| | ||    
15907490 tgaaacagattcaatgctagttacaatggcttttaagtcaaaaaaccattgttctttggaatctaaggaatagatgggataattgtttacacttagtttc 15907391  T
200 ctcaatgtcttttattgtttctt 222  Q
     ||||| ||||| ||||||||||    
15907390 ttcaatatctttcattgtttctt 15907368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 81 - 214
Target Start/End: Original strand, 18285656 - 18285789
Alignment:
81 ggttggaatcacttatggattgaaacaggctcaatgttagtcactttggctttcaagtctaaatccattgtgccttggcacttaaggaataggtgggata 180  Q
    ||||||||||| || ||||||||||||   || |||||||||||||| ||||| || || |||||||| ||||||||| ||||||| || | |||||| |    
18285656 ggttggaatcaattgtggattgaaacaaattctatgttagtcactttagcttttaaatcaaaatccatagtgccttggaacttaagaaacaagtgggaaa 18285755  T
181 actgtttacatttactctcctcaatgtcttttat 214  Q
    | ||||||||| |  | |||||||||||||||||    
18285756 attgtttacatctgatttcctcaatgtcttttat 18285789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0023 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0023
Description:

Target: scaffold0023; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 81 - 217
Target Start/End: Complemental strand, 138812 - 138676
Alignment:
81 ggttggaatcacttatggattgaaacaggctcaatgttagtcactttggctttcaagtctaaatccattgtgccttggcacttaaggaataggtgggata 180  Q
    |||||||||||||||||| | ||||| |  |||||||| || || |||||||| || ||||     ||||| |||||||| ||||| || || ||||| |    
138812 ggttggaatcacttatggctggaaactgattcaatgttggtgaccttggcttttaaatctatgaagattgttccttggcaattaagaaacagatgggaaa 138713  T
181 actgtttacatttactctcctcaatgtcttttattgt 217  Q
    |||||||||||||| | || |||||||||||| ||||    
138712 actgtttacatttaatatcatcaatgtctttttttgt 138676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 126 - 194
Target Start/End: Complemental strand, 27362289 - 27362221
Alignment:
126 ttggctttcaagtctaaatccattgtgccttggcacttaaggaataggtgggataactgtttacattta 194  Q
    |||||||||||||| ||||| ||||||||||||||  | |||||||||||||| |||||  ||||||||    
27362289 ttggctttcaagtcaaaatctattgtgccttggcaactgaggaataggtgggagaactgcatacattta 27362221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 36 - 172
Target Start/End: Complemental strand, 22162418 - 22162282
Alignment:
36 gagcttaatggagccatgataacaatataattggattctcaaaagggttggaatcacttatggattgaaacaggctcaatgttagtcactttggctttca 135  Q
    ||||||||||||||||||||  ||||  |||| | |||||||||||| ||| ||||| | ||| | |||||||  || ||||| || |||   |||||||    
22162418 gagcttaatggagccatgatggcaattgaattcgcttctcaaaaggggtggcatcacctttggctagaaacagattctatgttggtaactgcagctttca 22162319  T
136 agtctaaatccattgtgccttggcacttaaggaatag 172  Q
    ||||||   | || || |||||||||||||| |||||    
22162318 agtctatcacgatcgttccttggcacttaagaaatag 22162282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University