View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21165_high_67 (Length: 215)
Name: NF21165_high_67
Description: NF21165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21165_high_67 |
 | |
|
| [»] scaffold0300 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0300 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: scaffold0300
Description:
Target: scaffold0300; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 17 - 199
Target Start/End: Original strand, 3769 - 3951
Alignment:
| Q |
17 |
agacaccagatcaatctctaaaatgaaaatatcttaaaagaaacacaaattttgcggaacttcaacgagaatgtgagaatgaatttcgattttgttacct |
116 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3769 |
agacaccagatcaatctctaaaatgaacatatcttaagagaaacacaaattttgcggaacttcaacgagaatgtgagaatgaatttcgattttgttacct |
3868 |
T |
|
| Q |
117 |
tcaattttgacggtcttcaattatgaaccggttaaagatgttccatgattaaggatttagggttcttactcttccaagcttca |
199 |
Q |
| |
|
|| |||||||||||||||| ||||||||||||||| ||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3869 |
tcgattttgacggtcttcagttatgaaccggttaaggatgttcgatgattggggatttagggttcttactcttccaagcttca |
3951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University