View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21165_low_19 (Length: 444)
Name: NF21165_low_19
Description: NF21165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21165_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 4e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 4e-82
Query Start/End: Original strand, 75 - 277
Target Start/End: Complemental strand, 7080152 - 7079950
Alignment:
| Q |
75 |
atttgttcgtcgtcgttttggtggattgtggtgttgtttaagtgggttttgagtgatgggtcgattagtgaagtgctggattcatatgaatggaaatgaa |
174 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||| |||||| ||||| | |
|
|
| T |
7080152 |
atttcttcatcgtcgttttggtggattgtggtgtcgtttaagtgggttttgagtgatgggtcgatcagtgaagtgctggattcatgtgaatgaaaatgga |
7080053 |
T |
 |
| Q |
175 |
gagttcggtgagtgatgattgatgaagaaatgggtaattgcttgaagagggttttggagaattgggaatttgagattgatttgagtttcgatagggtctg |
274 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| | |||||| || |
|
|
| T |
7080052 |
gagttcggtgagtgatgattgatgatgaaatgggtaattgtttgaagagggttttggagaattgggaatttgagattgatttgagtttggttagggtttg |
7079953 |
T |
 |
| Q |
275 |
ttt |
277 |
Q |
| |
|
||| |
|
|
| T |
7079952 |
ttt |
7079950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University