View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21165_low_37 (Length: 344)
Name: NF21165_low_37
Description: NF21165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21165_low_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 13 - 331
Target Start/End: Original strand, 45147827 - 45148145
Alignment:
| Q |
13 |
ctatgatataactagcttgaatgaatttagagattctcactgctttcaatcatttgactcttctcaattgtaggtggataatacatctgcacgggtgcag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45147827 |
ctatgatataactagcttgaatgaatttagagattctcactgctttcaatcatttgactcttctcaattgtaggtggataatacatctgcacgggtgcag |
45147926 |
T |
 |
| Q |
113 |
caatggggtggacaaaccgtagaagttgacagcaatggggtggacaagccatagaagttgacgagacattgtattccgcataaagttgcacgtatctccc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45147927 |
caatggggtggacaaaccgtagaagttgacagcaatggggtggacaagccatagaagttgacgagacattgtattccgcataaagttgcacgtatctccc |
45148026 |
T |
 |
| Q |
213 |
acttcctacctgttctcttgtaaaattagggataatggtctcaaaaatcctttctgaccattttgcattgtaatgtagtagtttgtttctttcaattagg |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45148027 |
acttcctacctgttctcttgtaaaattagggataatggtctcaaaaatcctttctgaccattttgcattgtaatgtagtagtttgtttctttcaattagg |
45148126 |
T |
 |
| Q |
313 |
ttcatgacataatctgtct |
331 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
45148127 |
ttcatgacataatctgtct |
45148145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University