View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21165_low_61 (Length: 252)
Name: NF21165_low_61
Description: NF21165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21165_low_61 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 11 - 233
Target Start/End: Original strand, 31454992 - 31455214
Alignment:
| Q |
11 |
cagagacaattcaaagtgatttagttgtgcttgcagagctatacaattgcatggaagaactcttccaatctcaacaaacacaacaagcacttttacacta |
110 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31454992 |
cagagacaattcaaagtgatttggttgtgcttgctgagttatacaattgcatggaagaactcttccaatctcaacaaacacaacaagcacttttacacta |
31455091 |
T |
 |
| Q |
111 |
tcaaaatgggaagctagtggaagattcattaagtggttcagttacacttttagatgcatgtagttcatcaagggaattactcttgaatctcaaggaacat |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31455092 |
tcaaaatgggaagctagtggaagattcattaagtggttcagttacacttttagatgcatgtggttcatcaagggaattactcttgaatctcaaggaacat |
31455191 |
T |
 |
| Q |
211 |
gtggaaacacttcaatccgctat |
233 |
Q |
| |
|
||||||||||||||||| ||||| |
|
|
| T |
31455192 |
gtggaaacacttcaatcggctat |
31455214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 9 - 96
Target Start/End: Complemental strand, 9385463 - 9385376
Alignment:
| Q |
9 |
agcagagacaattcaaagtgatttagttgtgcttgcagagctatacaattgcatggaagaactcttccaatctcaacaaacacaacaa |
96 |
Q |
| |
|
|||||||| |||||| ||||| ||||| | |||||||||| | |||||||| ||||||||||||||| | |||| |||||| |||||| |
|
|
| T |
9385463 |
agcagagaaaattcagagtgacttagtagggcttgcagagatttacaattgtatggaagaactcttcaactctccacaaactcaacaa |
9385376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University