View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21165_low_66 (Length: 238)
Name: NF21165_low_66
Description: NF21165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21165_low_66 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 10 - 222
Target Start/End: Complemental strand, 17096827 - 17096615
Alignment:
| Q |
10 |
tgagaagaattcaggataaaattgacctcaagatcaagaaagactaaaaatgaacaaccaaatggtcaaaggtagggaattttactacttcagtgaagac |
109 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
17096827 |
tgagaagaattcaagatgaaattgacctcaagatcaagaaagactaaaaataaacaaccaaatggtcaaagagagggaattttactacttcagtgaagac |
17096728 |
T |
 |
| Q |
110 |
acaaccaaggacatactattgaaatttattttgaagcgttcgtagcaggaacaaagttgtgacattgttaataagttgtgaagtaaaagttgagttatag |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17096727 |
acaaccaaggacatactattgaaatttattttgaagcgttcttagcaggaacaaagttgtgacattgttaataagttgtgaagtaaaagttgagttatag |
17096628 |
T |
 |
| Q |
210 |
ctagggagatact |
222 |
Q |
| |
|
||||||||||||| |
|
|
| T |
17096627 |
ctagggagatact |
17096615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University